OSCR

DCPS modulates TDP-43-linked neurodegeneration through P-body-mediated RNA decay.

Code ↔ Paper

1 match between paragraphs of the paper and lines of its authors' code, computed by the harvester (lexical-v1). Click a colored paragraph or line to see its counterpart.

The 1 match
  1. [1] § STAR★METHODS › METHOD DETAILS › ARTR-seq analysis ↔ bash_script.sh, lines 1–62 · score 0.56 · rRNA, STAR, Bowtie2, Cutadapt, hg38, trimmed

Paper

Loaded from Europe PMC by your browser, not stored by OSCR: doi.org · Europe PMC

The paper is loaded when this pane is shown.

The authors' code

Shell · 122 lines · 4.4 KB · no license · 1 match

  1. #!/bin/bash
  3. ### this script is modified from https://github.com/mingming-cgz/ARTR-seq/
  4. ## trimming
  5. # {}_R1_001.fastq.gz & {}_R2_001.fastq.gz as raw PE reads
  6. ls *_R1_001.fastq.gz \
  7. | awk -F "_R1_001.fastq.gz" '{print $1}' \
  8. | sort -u \
  9. | parallel "cutadapt -j $n_threads --nextseq-trim=20 --action=trim \
  10. -a AGATCGGAAGAGCACACGTCTGAACTCCAG \
  11. -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAG \
  12. -o {}_R1_001.trim.fastq.gz -p {}_R2_001.trim.fastq.gz {}_R1_001.fastq.gz {}_R2_001.fastq.gz"
  14. ## extracting umi
  15. ls *_R1_001.trim.fastq.gz \
  16. | awk -F "_R1_001.trim.fastq.gz" '{print $1}' \
  17. | sort -u \
  18. | parallel "cutadapt -j $n_threads -q 20 -m 20 --action=trim \
  19. -u 8 -u -4 -U -8 -U 4 \
  20. --rename='{id}_{r1.cut_prefix} {comment}' \
  21. -o {}_R1_001.trimMI.fastq.gz -p {}_R2_001.trimMI.fastq.gz {}_R1_001.trim.fastq.gz {}_R2_001.trim.fastq.gz"
  23. ## mapping to rRNA using bowtie2
  24. total_files=`find -name '*.gz' | wc -l`
  25. arr=( $(ls *.gz) )
  26. for ((i=0; i<$total_files; i+=2))
  27. {
  28. sample_name=$(echo ${arr[$i]} | sed 's/_R[12].*//')
  29. echo "[bowtie2 mapping running for sample] $sample_name"
  31. date && time bowtie2 --threads $n_threads --seedlen=15 \
  32. -x hg38_rRNA \
  33. -1 ${arr[$i]} -2 ${arr[$i+1]} \
  34. --un-conc-gz ${sample_name}_norRNA
  36. printf "\n\n"
  37. } > /dev/null
  39. ## re-mapping norRNA reads using STAR
  40. for r1_file in *_R1.fastq.gz; do
  41. r2_file="${r1_file/_R1.fastq.gz/_R2.fastq.gz}"
  42. sample_name=$(basename "$r1_file" | sed 's/_R1.fastq.gz//')
  43. output_dir="STAR/${sample_name}"
  44. mkdir -p "$output_dir"
  45. STAR --runMode alignReads --runThreadN $n_threads \
  46. --readFilesCommand zcat \
  47. --genomeDir refgenome/GRCh38 \
  48. --alignEndsType EndToEnd \
  49. --genomeLoad NoSharedMemory \
  50. --quantMode TranscriptomeSAM \
  51. --alignMatesGapMax 15000 \
  52. --readFilesIn "$r1_file" "$r2_file" \
  53. --outFileNamePrefix "${output_dir}/" \
  54. --outFilterMultimapNmax 1 \
  55. --outSAMattributes All \
  56. --outSAMtype BAM SortedByCoordinate \
  57. --outFilterType BySJout \
  58. --outReadsUnmapped Fastx \
  59. --outFilterScoreMin 10 \
  60. --outFilterMatchNmin 24 \
  61. > "${output_dir}/STAR_log.txt" 2>&1
  62. done
  64. ## dedup using UMItools
  65. ls *.bam | parallel samtools index -@ $n_threads '{}'
  66. find . -name "*.sortedByCoord.out.bam" | parallel -j $n_threads ' \
  67. filename=$(basename {} .sortedByCoord.out.bam); \
  68. umi_tools dedup --method unique \
  69. -I {} \
  70. --output-stats=${filename}_dedup \
  71. -L ${filename}_umitools.log \
  72. --temp-dir=dedup_temp \
  73. -S ${filename}.sort.dedup.bam'
  75. ## splitting strands
  76. for file in *_L001_norRNA_Aligned.sort.dedup.bam
  77. do filename="${file%%.*}"
  78. samtools view -@ $n_threads -f 16 $file -b -o ${filename}.sort.dedup.reverse.bam
  79. samtools view -@ $n_threads -F 16 $file -b -o ${filename}.sort.dedup.forward.bam
  80. done
  81. ls *.bam | parallel samtools index -@ $n_threads '{}'
  83. ## call peaks using macs3: do fwd and rev seperately
  84. macs3 callpeak --treatment IP_1.bam IP_2.bam IP_3.bam\
  85. --control Input_1.bam Input_2.bam Input_3.bam\
  86. -f BAM -n $sample_name -g hs -B \
  87. --keep-dup all \
  88. --nomodel --extsize 30
  90. ## combine peaks
  91. for fwd_file in *_fwd_peaks.narrowPeak; do
  92. # Derive the sample name by removing the "_fwd_peaks.narrowPeak" suffix
  93. sample_name="${fwd_file%_fwd_peaks.narrowPeak}"
  95. # Find the corresponding reverse file
  96. rev_file="${sample_name}_rev_peaks.narrowPeak"
  98. # Check if the reverse file exists
  99. if [[ -f "$rev_file" ]]; then
  100. # Combine forward and reverse files
  101. combined_file="${sample_name}_combined_peaks.narrowPeak"
  103. echo "Combining $fwd_file and $rev_file into $combined_file"
  105. # Annotate strands and combine
  106. awk 'BEGIN{FS="\t"; OFS="\t"} {$6 = "+"; print $0}' "$fwd_file" > "$combined_file"
  107. awk 'BEGIN{FS="\t"; OFS="\t"} {$6 = "-"; print $0}' "$rev_file" >> "$combined_file"
  108. else
  109. echo "Warning: Reverse file for $sample_name not found"
  110. fi
  111. done
  113. ## making a ref peak saf file
  114. cat *.narrowPeak > all_peaks.narrowPeak
  115. sort -k1,1 -k2,2n -k6,6 all_peaks.narrowPeak > all_peaks_sorted.narrowPeak
  116. bedtools merge -i all_peaks_sorted.narrowPeak -s -c 6 -o distinct > all_peaks_merged.bed
  117. awk 'BEGIN { OFS="\t"; print "GeneID", "Chr", "Start", "End", "Strand" }
  118. { print "Peak" NR, $1, $2, $3, $4 }' all_peaks_merged.bed > all_peaks_merged.saf
  120. ## count peaks using subread
  121. featureCounts -F SAF -a all_peaks_merged.saf -o peak_counts_s1.txt -s 1 -T $n_threads -p -B -C *.bam
  122. featureCounts -F SAF -a all_peaks_merged.saf -o peak_counts_s2.txt -s 2 -T $n_threads -p -B -C *.bam

bash_script.sh at commit ad2756b, no license · at the source

Overview

Authors: Yingzhi Ye1,2,3,4, Zhe Zhang1,2,4, Yu Xiao5,6, Chengzhang Zhu1,2,7, Noelle Wright1,2,3, Julie Asbury1,2, Yongxin Huang1,2,3, Weiren Wang1,2, Laura Gomez-Isaza8, Juan C. Troncoso8, Chuan He5,6,9, Shuying Sun1,2,8,10,11
ORCID iDs: Yingzhi Ye, Chengzhang Zhu, Noelle Wright, Shuying Sun
  1. Department of Physiology, Pharmacology & Therapeutics, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
  2. Brain Science Institute, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
  3. Cellular and Molecular Physiology Graduate Program, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
  4. This authors contributed equally
  5. Department of Chemistry and Institute for Biophysical Dynamics, University of Chicago, Chicago, IL 60637, USA
  6. Howard Hughes Medical Institute, Chicago, IL 60637, USA
  7. Cellular and Molecular Medicine Graduate Program, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
  8. Department of Pathology, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
  9. Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, IL 60637, USA
  10. The Solomon H. Snyder Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
  11. Lead contact
Institutions: Johns Hopkins University (United States); Johns Hopkins Medicine (United States); Howard Hughes Medical Institute (United States); University of Chicago (United States)
Journal: Neuron, volume 114, issue 11, pages 1970-1985.e12
Dates: published online 9 March 2026; in print 3 June 2026
Type: Research article · Language: English
License: CC BY-NC-ND
Identifiers: DOI 10.1016/j.neuron.2026.01.018 · PMID 41943580 · PMCID PMC13058276 · OpenAlex W7134254437
Open access: hybrid, a free copy (OpenAlex)
Status: code verified
Categories: human (organism), other condition (population), Alzheimer's / dementia (population), cellular / molecular (subfield)
Methods: Statistics, Evoked potentials, Smoothing, state filtering, decompositions
Keywords: Neurodegeneration, ALS, Tdp-43, Ftd, Rna Decay, Dcps, P-body
MeSH: DNA-Binding Proteins*, Endoribonucleases*, Neurodegenerative Diseases*, Processing Bodies*, RNA Stability*, Amyotrophic Lateral Sclerosis, Animals, Humans, Neurons, RNA, Messenger (* major topic)
Topic: Amyotrophic Lateral Sclerosis Research (Neurology, Medicine), according to OpenAlex
Funding: National Institute on Aging; NHGRI NIH HHS (RM1 HG008935); Johns Hopkins University Robert Packard Center for ALS Research; NINDS NIH HHS (R01 NS127925, RF1 NS113820); NIA NIH HHS (R01 AG078948); National Institute of Neurological Disorders and Stroke
Citations: cited by 3 papers (Europe PMC); 105 references in the paper
Research resources: Rabbit anti-FLAG RRID:AB_11232216, Rabbit anti-EDC4 RRID:AB_1268717, Rabbit anti-HA RRID:AB_1549585, Rabbit anti-Cleaved-Caspase-3 RRID:AB_2070042, Rabbit anti-EDC3 RRID:AB_2095946, Rabbit anti-DCP2 RRID:AB_2230386, Chicken anti-MAP2 RRID:AB_2492335, RRID:AB_2534069, RRID:AB_2534071, RRID:AB_2534077, Mouse anti-puromycin RRID:AB_2566826, RRID:AB_2576217, Mouse anti-FLAG RRID:AB_262044, Rabbit anti-NeuN RRID:AB_2630395, Rabbit anti-MAP2 RRID:AB_2722660, RRID:AB_2762845, Rabbit anti-DCP2 RRID:AB_2899738, Mouse anti-m7G-cap RRID:AB_2921296, Mouse anti-PSD-95 RRID:AB_303248, Mouse anti-TDP-43 phospho-Ser409/410 RRID:AB_3251193, Mouse anti-G3BP1 RRID:AB_398437, Mouse anti-TDP-43 RRID:AB_425904, Rabbit anti-GAPDH RRID:AB_561053, Rabbit anti-TDP-43 RRID:AB_615042, Mouse anti-HuR RRID:AB_627770, RRID:AB_772206, RRID:AB_772210, Plasmid: pLKO.1-control shRNA RRID:Addgene_10879, Plasmid: pMDLg/pRRE RRID:Addgene_12251, Plasmid: pRSV-Rev RRID:Addgene_12253, Plasmid: pMD2.G RRID:Addgene_12259, Plasmid: pT7-EGFP-C1-HsDCP2 RRID:Addgene_25031, HEK293T RRID:CVCL_0063, CS0594iCTR RRID:CVCL_YB28, RStudio RRID:SCR_000432, Fiji image processing package RRID:SCR_002285, GraphPad Prism RRID:SCR_002798, STAR (version 2.7.9a) RRID:SCR_004463, Subread (version 2.0.1) RRID:SCR_009803, Integrative Genomics Viewer (IGV) RRID:SCR_011793, Cutadapt (version 5.0) RRID:SCR_011841, Trim Galore (version 0.6.7) RRID:SCR_011847, MACS (version 3.0.2) RRID:SCR_013291, GENCODE (version 38) RRID:SCR_014966, HISAT2 (version 2.2.1) RRID:SCR_015530, DESeq2 (version 1.40.2) RRID:SCR_015687, Deeptools (version 3.5.1) RRID:SCR_016366, Bowtie2 (version 2.3.5.1) RRID:SCR_016368, clusterProfiler (version 4.8.3) RRID:SCR_016884, UMI-tools (version 1.1.6) RRID:SCR_017048, ChIPseeker (version 1.36.0) RRID:SCR_021322, rMATS (version 4.1.1) RRID:SCR_023485

Abstract

The abstract is not reproduced here: the paper's license (CC BY-NC-ND) does not allow it. Read it in the paper, at the publisher or on Europe PMC.

Repositories

Its files are read in the Code ↔ Paper reader above, with 1 match between paragraphs and lines of code.

yye24/jhu2025

License: none: the authors keep all their rights
State: the link answers, verified on 30 September 2026
Evidence: files inventoried
Commit: ad2756b0fa50d4c7e946bdc32621e82fde132bd4, 11 June 2025
Languages: R (1), Shell (1)
Size: 2 files, 2 scripts
Software Heritage: not archived
Found in: “Data and code availability”
Holds: 1 notebook
Not found: README, license file, CITATION.cff, environment file, tests, continuous integration, documentation
Tools: BEDTools (1 file), clusterProfiler (1 file), DESeq2 (1 file), SAMtools (1 file), STAR (1 file), Subread (featureCounts) (1 file), tidyverse (1 file)
Availability: 1 check, the latest on 30 September 2026: the link answers
  • 30 September 2026: the link answers
2 files
At the source: github.com/yye24/jhu2025

mingming-cgz/artr-seq

License: MIT
State: the link answers, verified on 30 September 2026
Evidence: files inventoried
Commit: 0571741f0f14ea1939ff7573d81e531ca33aa918, 29 August 2023
Languages: Shell (4)
Size: 6 files, 4 scripts
Software Heritage: not archived
Found in: the text, “ARTR-seq analysis”
Holds: README, license file
Not found: CITATION.cff, environment file, tests, continuous integration, documentation
Tools: SAMtools (1 file), STAR (1 file)
Availability: 1 check, the latest on 30 September 2026: the link answers
  • 30 September 2026: the link answers
6 files
At the source: github.com/mingming-cgz/ARTR-seq/tree/main

The paper's code and data availability statement is in the Data section.

Tracing map

Proposed by the machine: these links were found in the paper and verified at the source, without human review. The map will receive a Zenodo DOI once one of the paper's authors has validated it with their ORCID.

What the map holds:

  • 2 repositories of the authors' code, each at its verified commit, with its license and how the link was found in the paper;
  • 6 scripts, each with its path and the digest of its content;
  • 1 match between paragraphs of the paper and lines of the code (method lexical-v1);
  • neither the text of the paper nor the code itself.

Its JSON (tracing-map.json) is deposited on Zenodo with its DOI once the map is validated.

Data

No dataset and no data link were found in the paper.

Code and data availability statement

The paper has a code and data availability statement. Its license (CC BY-NC-ND) does not allow reproducing it here; in short, from what the harvester recognized in it:

  • it points to the authors' code: yye24/jhu2025
  • it says that the data are available on request
  • it says that the code is available on request

Read it in the paper: doi.org/10.1016/j.neuron.2026.01.018.

Versions

The history of this record: each version stored by the harvester or made by a correction of its authors or of the maintainers of its code, and what changed in its facts. The texts of the paper (its abstract, its availability statements) are not part of it; versions that changed only those are not listed.

Version 1, 30 September 2026: the first record

Recorded: type, language, journal, volume, issue, pages, dates, 12 authors, 7 keywords, 10 MeSH terms, 6 funders, 104 references, 52 RRIDs.

Cite

This paper

Ye, Y., Zhang, Z., Xiao, Y., Zhu, C., Wright, N., Asbury, J., Huang, Y., Wang, W., Gomez-Isaza, L., Troncoso, J. C., He, C., & Sun, S. (2026). DCPS modulates TDP-43-linked neurodegeneration through P-body-mediated RNA decay. Neuron, 114(11), 1970-1985.e12. https://doi.org/10.1016/j.neuron.2026.01.018

BibTeX

@article{ye2026dcps,
author = {Ye, Yingzhi and Zhang, Zhe and Xiao, Yu and Zhu, Chengzhang and Wright, Noelle and Asbury, Julie and Huang, Yongxin and Wang, Weiren and Gomez-Isaza, Laura and Troncoso, Juan C. and He, Chuan and Sun, Shuying},
title = {{DCPS modulates TDP-43-linked neurodegeneration through P-body-mediated RNA decay}},
journal = {Neuron},
year = {2026},
month = mar,
volume = {114},
number = {11},
pages = {1970--1985.e12},
publisher = {Cell Press},
issn = {0896-6273},
doi = {10.1016/j.neuron.2026.01.018},
url = {https://doi.org/10.1016/j.neuron.2026.01.018},
pmid = {41943580},
pmcid = {PMC13058276}
}

RIS

TY - JOUR
AU - Ye, Yingzhi
AU - Zhang, Zhe
AU - Xiao, Yu
AU - Zhu, Chengzhang
AU - Wright, Noelle
AU - Asbury, Julie
AU - Huang, Yongxin
AU - Wang, Weiren
AU - Gomez-Isaza, Laura
AU - Troncoso, Juan C.
AU - He, Chuan
AU - Sun, Shuying
TI - DCPS modulates TDP-43-linked neurodegeneration through P-body-mediated RNA decay
T2 - Neuron
J2 - Neuron
PY - 2026
DA - 2026/03/09
VL - 114
IS - 11
SP - 1970
EP - 1985.e12
SN - 0896-6273
PB - Cell Press
DO - 10.1016/j.neuron.2026.01.018
UR - https://doi.org/10.1016/j.neuron.2026.01.018
LA - en
ER -

CSL-JSON

{
"id": "10.1016/j.neuron.2026.01.018",
"type": "article-journal",
"title": "DCPS modulates TDP-43-linked neurodegeneration through P-body-mediated RNA decay",
"container-title": "Neuron",
"author": [
{
"family": "Ye",
"given": "Yingzhi"
},
{
"family": "Zhang",
"given": "Zhe"
},
{
"family": "Xiao",
"given": "Yu"
},
{
"family": "Zhu",
"given": "Chengzhang"
},
{
"family": "Wright",
"given": "Noelle"
},
{
"family": "Asbury",
"given": "Julie"
},
{
"family": "Huang",
"given": "Yongxin"
},
{
"family": "Wang",
"given": "Weiren"
},
{
"family": "Gomez-Isaza",
"given": "Laura"
},
{
"family": "Troncoso",
"given": "Juan C."
},
{
"family": "He",
"given": "Chuan"
},
{
"family": "Sun",
"given": "Shuying"
}
],
"container-title-short": "Neuron",
"volume": "114",
"issue": "11",
"page": "1970-1985.e12",
"DOI": "10.1016/j.neuron.2026.01.018",
"PMID": "41943580",
"PMCID": "PMC13058276",
"ISSN": "0896-6273",
"publisher": "Cell Press",
"URL": "https://doi.org/10.1016/j.neuron.2026.01.018",
"language": "en",
"issued": {
"date-parts": [
[
2026,
3,
9
]
]
}
}

The tracing map gets a citation of its own once an author has validated it and it has a DOI.

Similar papers

The papers with a page that share the most with this one: the tools found in their code, their categories, datasets, cited references and authors, the rarest counting most.

[1] doi:10.1186/s13024-026-00944-2
TDP-43: [GU]-ardian of the transcriptome.
Journal: Molecular neurodegeneration
In common: other condition, cellular / molecular, 36 references
[2] doi:10.1038/s41467-026-69944-6 [code]
Multi-modal dissection of cell-type specific TDP-43 pathology in the motor cortex.
Journal: Nature communications
In common: BEDTools, SAMtools, DESeq2, 2 other tools, other condition, 10 references
[3] doi:10.1038/s41586-026-10512-9 [code]
Astrocyte glucocorticoid receptor signalling restricts neuronal plasticity.
Journal: Nature
In common: Subread (featureCounts), STAR, BEDTools, 4 other tools, cellular / molecular, 6 references
[4] doi:10.1126/sciadv.aed2952 [code]
Activation of transposable elements is linked to a region- and cell type-specific interferon response in Parkinson's disease.
Journal: Science advances
In common: Subread (featureCounts), STAR, BEDTools, 4 other tools, cellular / molecular, 5 references
[5] doi:10.1038/s41467-026-70243-3 [code]
TYK2 mediates neuroinflammation in Alzheimer's disease brains with TDP-43 pathology.
Journal: Nature communications
In common: SAMtools, tidyverse, Alzheimer's / dementia, cellular / molecular, 9 references
[6] doi:10.7554/elife.107393 [code]
Chromosome-scale genome assembly of the European common cuttlefish &lt;i&gt;Sepia officinalis&lt;/i&gt;.
Journal: eLife
In common: Subread (featureCounts), STAR, BEDTools, 4 other tools, cellular / molecular, 4 references
[7] doi:10.21203/rs.3.rs-9927928/v1 [code]
Genome-wide and allele-resolved maps of the radial architecture of the mouse genome
Journal: Research Square (preprint)
In common: Subread (featureCounts), STAR, BEDTools, 4 other tools, 4 references
[8] doi:10.1093/bioinformatics/btag592 [code]
Network-based stratification of allele-specific expression reveals patient subgroups in Huntington's disease.
Journal: Bioinformatics (Oxford, England)
In common: Subread (featureCounts), STAR, SAMtools, 3 other tools, other condition, 4 references
[9] doi:10.1038/s41531-026-01287-x [code]
Faecalibacterium prausnitzii, depleted in the Parkinson's disease microbiome, improves motor deficits in α-synuclein overexpressing mice.
Journal: NPJ Parkinson's disease
In common: Subread (featureCounts), STAR, SAMtools, 3 other tools, cellular / molecular, 4 references
[10] doi:10.1038/s41467-026-71432-w [code]
MeCP2 gene dosage-dependent neurodevelopmentally restricted defects arise by aberrant activation of cell fate-determining bivalent genes.
Journal: Nature communications
In common: Subread (featureCounts), STAR, BEDTools, 4 other tools, other condition, cellular / molecular

Contribute

The authors of this paper can claim it, correct its record and validate its tracing map, and the maintainers of its code (its owner, or a public member of its organization) correct what it says of their repository; anyone signed in can ask for its removal. Every request goes to OSCR's own machine, which answers it; your account page follows them.

Sign in with ORCID to claim this paper as one of its authors, correct its record or validate its tracing map: when the paper's metadata lists your ORCID iD, you are recognized at once. Maintainers of its code: sign in with GitHub, then claim the repository on your account page.

Request its removal

To ask OSCR to remove this record, the copies of its authors' scripts or its tracing map, use the removal request page: signed in, you say who you are, what to remove and why, then review and confirm the request. Published rules decide every request (how).

Discussion, reproductions, activity

Discussion: questions and error reports about this paper and its code, from signed-in readers and its authors. It opens with sign-in.

Reproductions: reports from readers who ran the authors' code: what they reproduced, with which environment, commit and data. It opens with sign-in.

Activity: what happens around this paper: new versions of its record, its map's validation, discussions and reproductions. It opens with sign-in.